upload
Food and Agriculture Organization of the United Nations
行业: Agriculture
Number of terms: 87409
Number of blossaries: 0
Company Profile:
Established in October 1945 with the objective of eliminating hunger and improving nutrition and standards of living by increasing agricultural productivity, FAO coordinates the efforts of governments and technical agencies in programs for developing agriculture, forestry, fisheries, and land and ...
The strand of duplex DNA which contains the same base sequence (after substituting U for T) found in the mRNA molecule resulting from transcription of that segment of DNA. a.k.a. sense strand. The mRNA molecule is transcribed from the other strand, known as the template or antisense strand. Coding strand 5´ ATGAAAGCTTTAGTGGGCGCCCGTAT 3´ Template strand 3´ TACTTTCGAAATCACCCGCGGGCATA 5´ mRNA 5´ AUGAAAGCUUUAGUGGGCGCCCGUAU 3´
Industry:Biotechnology
The strand of the DNA double helix that is actually transcribed. Also known as the antisense or template strand.
Industry:Biotechnology
The structure formed when a double-stranded DNA molecule containing an inverted repeat sequence is denatured and then allowed to re-anneal at low DNA concentrations. The repeated sequence permits the formation of a double-stranded region within each of the separated strands of the original molecule.
Industry:Biotechnology
cap
The structure found on the 5´-end of eukaryotic mRNA, and consisting of an inverted, methylated guanosine residue.
Industry:Biotechnology
The structure in angiosperms (flowering plants) that bears the organs for sexual reproduction.
Industry:Biotechnology
The study of the flow and the transformations of energy that occur in living organisms.
Industry:Biotechnology
The study of the fossil record of past geological periods and of the phylogenetic relationships between extinct and contemporary plant and animal species.
Industry:Biotechnology
The study of the interactions between organisms and their natural environment, both living and non-living.
Industry:Biotechnology
The study of the structure and function of cells.
Industry:Biotechnology
The substitution in DNA or RNA of one purine by another purine, or of one pyrimidine by another pyrimidine.
Industry:Biotechnology
© 2024 CSOFT International, Ltd.